Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105675 |
| Name | oriT_pEcl2-3  |
| Organism | Enterobacter hormaechei strain Eho-2 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP047760 (36365..36462 [+], 98 nt) |
| oriT length | 98 nt |
| IRs (inverted repeats) | 78..83, 88..93 (AAAAAT..ATTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 98 nt
>oriT_pEcl2-3
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATGACCATTTAAGGGTTAAAAAATCATCATTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATGACCATTTAAGGGTTAAAAAATCATCATTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6112 | GenBank | NZ_CP047760 |
| Plasmid name | pEcl2-3 | Incompatibility group | IncR |
| Plasmid size | 37703 bp | Coordinate of oriT [Strand] | 36365..36462 [+] |
| Host baterium | Enterobacter hormaechei strain Eho-2 |
Cargo genes
| Drug resistance gene | mph(A), sul1, qacE, ant(3'')-Ia, blaVIM-1, tet(A) |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |