Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105672 |
| Name | oriT_LG728|unnamed3  |
| Organism | Lactococcus garvieae strain LG728 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP071289 (11413..11549 [-], 137 nt) |
| oriT length | 137 nt |
| IRs (inverted repeats) | 25..30, 39..44 (GGGGAA..TTCCCC) |
| Location of nic site | 104..105 |
| Conserved sequence flanking the nic site |
GCTTGCAGTA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 137 nt
>oriT_LG728|unnamed3
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCATTTTCAAGCTACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATGTTTGCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCATTTTCAAGCTACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATGTTTGCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6109 | GenBank | NZ_CP071289 |
| Plasmid name | LG728|unnamed3 | Incompatibility group | - |
| Plasmid size | 18072 bp | Coordinate of oriT [Strand] | 11413..11549 [-] |
| Host baterium | Lactococcus garvieae strain LG728 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |