Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105672
Name   oriT_LG728|unnamed3 in_silico
Organism   Lactococcus garvieae strain LG728
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP071289 (11413..11549 [-], 137 nt)
oriT length   137 nt
IRs (inverted repeats)      25..30, 39..44  (GGGGAA..TTCCCC)
Location of nic site      104..105
Conserved sequence flanking the
  nic site  
 
 GCTTGCAGTA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 137 nt

>oriT_LG728|unnamed3
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCATTTTCAAGCTACATTGTAATACAAGAACGAAGTGCTTTGTATTACAATGTGATAGCTTGCAGTATTTATGGTTTTATGTTTGCTATTTTGTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6109 GenBank   NZ_CP071289
Plasmid name   LG728|unnamed3 Incompatibility group   -
Plasmid size   18072 bp Coordinate of oriT [Strand]   11413..11549 [-]
Host baterium   Lactococcus garvieae strain LG728

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -