Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105635 |
| Name | oriT_pSF25509a  |
| Organism | Sinorhizobium fredii CCBAU 25509 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP029453 (40847..40903 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | 4..9, 23..28 (GGAAAA..TTTTCC) 6..11, 20..25 (AAAATG..CATTTT) |
| Location of nic site | 36..37 |
| Conserved sequence flanking the nic site |
TCCTGCCCCT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pSF25509a
GCAGGAAAATGGCGTAGCACATTTTTCCGTATCCTGCCCCTCTAAATTGTAAGGGGA
GCAGGAAAATGGCGTAGCACATTTTTCCGTATCCTGCCCCTCTAAATTGTAAGGGGA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 390954..400026
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| AOX55_RS33350 (AOX55_00004637) | 386116..386409 | + | 294 | Protein_385 | helix-turn-helix domain-containing protein | - |
| AOX55_RS33355 (AOX55_00004638) | 386432..386644 | - | 213 | WP_014858049 | DUF5372 family protein | - |
| AOX55_RS33360 | 386740..386997 | + | 258 | Protein_387 | IS21 family transposase | - |
| AOX55_RS33365 | 387038..387268 | + | 231 | Protein_388 | AAA family ATPase | - |
| AOX55_RS33370 | 387404..387637 | - | 234 | WP_010875417 | helix-turn-helix transcriptional regulator | - |
| AOX55_RS33375 (AOX55_00004642) | 387856..388179 | + | 324 | WP_014858045 | transcriptional repressor TraM | - |
| AOX55_RS33380 | 388183..388895 | - | 713 | Protein_391 | autoinducer binding domain-containing protein | - |
| AOX55_RS33385 (AOX55_00004646) | 389198..390492 | - | 1295 | Protein_392 | IncP-type conjugal transfer protein TrbI | - |
| AOX55_RS33390 (AOX55_00004647) | 390504..390950 | - | 447 | WP_014858040 | conjugal transfer protein TrbH | - |
| AOX55_RS33395 (AOX55_00004648) | 390954..391766 | - | 813 | WP_014858039 | P-type conjugative transfer protein TrbG | virB9 |
| AOX55_RS33400 (AOX55_00004649) | 391784..392446 | - | 663 | WP_014858038 | conjugal transfer protein TrbF | virB8 |
| AOX55_RS33405 (AOX55_00004650) | 392470..393645 | - | 1176 | WP_034859627 | P-type conjugative transfer protein TrbL | virB6 |
| AOX55_RS33410 (AOX55_00004651) | 393639..393836 | - | 198 | WP_014858036 | entry exclusion protein TrbK | - |
| AOX55_RS33415 (AOX55_00004652) | 393833..394636 | - | 804 | WP_014858035 | P-type conjugative transfer protein TrbJ | virB5 |
| AOX55_RS33420 (AOX55_00004653) | 394608..396839 | - | 2232 | Protein_399 | conjugal transfer protein TrbE | - |
| AOX55_RS33425 (AOX55_00004654) | 396918..397940 | + | 1023 | WP_014328393 | IS110 family transposase | - |
| AOX55_RS33430 (AOX55_00004655) | 398140..398373 | - | 234 | WP_014858033 | hypothetical protein | virb4 |
| AOX55_RS33435 (AOX55_00004656) | 398384..398683 | - | 300 | WP_010875429 | conjugal transfer protein TrbD | virB3 |
| AOX55_RS33440 (AOX55_00004657) | 398676..399059 | - | 384 | WP_034859524 | TrbC/VirB2 family protein | virB2 |
| AOX55_RS33445 (AOX55_00004658) | 399049..400026 | - | 978 | WP_015633597 | P-type conjugative transfer ATPase TrbB | virB11 |
| AOX55_RS33450 (AOX55_00004661) | 400037..400663 | - | 627 | WP_014858030 | acyl-homoserine-lactone synthase | - |
Host bacterium
| ID | 6072 | GenBank | NZ_CP029453 |
| Plasmid name | pSF25509a | Incompatibility group | - |
| Plasmid size | 401505 bp | Coordinate of oriT [Strand] | 40847..40903 [-] |
| Host baterium | Sinorhizobium fredii CCBAU 25509 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | nodA, nodB, nodC, nodI, nodJ, nifS, fixU, nifZ, nifB, fixX, fixC, fixB, fixA, nifH, nifD, nifK, nifE, nifX, nodD, nodZ, nolV, nolU, nolT, nopB, nolW, nolX, mLTONO_5203 |
| Anti-CRISPR | AcrIC6 |