Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105621 |
| Name | oriT_p388  |
| Organism | Enterobacter hormaechei strain 388 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP021168 (52872..52965 [+], 94 nt) |
| oriT length | 94 nt |
| IRs (inverted repeats) | 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 94 nt
>oriT_p388
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6058 | GenBank | NZ_CP021168 |
| Plasmid name | p388 | Incompatibility group | IncFIA |
| Plasmid size | 79064 bp | Coordinate of oriT [Strand] | 52872..52965 [+] |
| Host baterium | Enterobacter hormaechei strain 388 |
Cargo genes
| Drug resistance gene | floR, tet(D), aac(6')-Ib-cr, ARR-3, dfrA27, aadA16, qacE, sul1, blaNDM-5, dfrA12, aadA2, qnrB6 |
| Virulence gene | - |
| Metal resistance gene | merA, merD, merE, merR, merT, merP, merC |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |