Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105606
Name   oriT_pCAV1321-1916 in_silico
Organism   Citrobacter freundii strain CAV1321
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP011603 (1484..1543 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pCAV1321-1916
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6044 GenBank   NZ_CP011603
Plasmid name   pCAV1321-1916 Incompatibility group   Col440I
Plasmid size   1916 bp Coordinate of oriT [Strand]   1484..1543 [-]
Host baterium   Citrobacter freundii strain CAV1321

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -