Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105603 |
| Name | oriT_53G|B  |
| Organism | Shigella sonnei 53G |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_016823 (3306..3380 [-], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_53G|B
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6041 | GenBank | NC_016823 |
| Plasmid name | 53G|B | Incompatibility group | ColRNAI |
| Plasmid size | 5153 bp | Coordinate of oriT [Strand] | 3306..3380 [-] |
| Host baterium | Shigella sonnei 53G |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |