Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 105602
• Name: oriT_pSS046_spB
• Organism: Shigella sonnei Ss046
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NC_009346 (3306..3380 [-], 75 nt)
• oriT length: 75 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 75 nt

>oriT_pSS046_spB
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 6040
• GenBank: NC_009346
• Plasmid name: pSS046_spB
• Incompatibility group: ColRNAI
• Plasmid size: 5153 bp
• Coordinate of oriT [Strand]: 3306..3380 [-]
• Host baterium: Shigella sonnei Ss046

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -