Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105602 |
Name | oriT_pSS046_spB |
Organism | Shigella sonnei Ss046 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NC_009346 (3306..3380 [-], 75 nt) |
oriT length | 75 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_pSS046_spB
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
GTCGGGGCAAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTACACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 6040 | GenBank | NC_009346 |
Plasmid name | pSS046_spB | Incompatibility group | ColRNAI |
Plasmid size | 5153 bp | Coordinate of oriT [Strand] | 3306..3380 [-] |
Host baterium | Shigella sonnei Ss046 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |