Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105601 |
| Name | oriT_pSS046_spA  |
| Organism | Shigella sonnei Ss046 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NC_009345 (4625..4684 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pSS046_spA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 6039 | GenBank | NC_009345 |
| Plasmid name | pSS046_spA | Incompatibility group | ColRNAI |
| Plasmid size | 8401 bp | Coordinate of oriT [Strand] | 4625..4684 [+] |
| Host baterium | Shigella sonnei Ss046 |
Cargo genes
| Drug resistance gene | tet(A), sul2, aph(3'')-Ib, aph(6)-Id |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |