Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105596 |
| Name | oriT_bat17|unnamed2  |
| Organism | Klebsiella pneumoniae strain bat17 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP092755 (79587..79636 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_bat17|unnamed2
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 58860..80194
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MKZ44_RS27790 (MKZ44_27785) | 54545..55276 | - | 732 | WP_004152622 | conjugal transfer complement resistance protein TraT | - |
| MKZ44_RS27795 (MKZ44_27790) | 55460..56008 | - | 549 | WP_004152623 | conjugal transfer entry exclusion protein TraS | - |
| MKZ44_RS27800 (MKZ44_27795) | 56021..58867 | - | 2847 | Protein_61 | conjugal transfer mating-pair stabilization protein TraG | - |
| MKZ44_RS27805 (MKZ44_27800) | 58860..60245 | - | 1386 | WP_240729869 | conjugal transfer pilus assembly protein TraH | traH |
| MKZ44_RS27810 (MKZ44_27805) | 60223..60666 | - | 444 | WP_004152679 | F-type conjugal transfer protein TrbF | - |
| MKZ44_RS27815 (MKZ44_27810) | 60712..61269 | - | 558 | WP_004152678 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| MKZ44_RS27820 (MKZ44_27815) | 61241..61480 | - | 240 | WP_004144400 | type-F conjugative transfer system pilin chaperone TraQ | - |
| MKZ44_RS27825 (MKZ44_27820) | 61491..62241 | - | 751 | Protein_66 | type-F conjugative transfer system pilin assembly protein TraF | - |
| MKZ44_RS27830 (MKZ44_27825) | 62262..62587 | - | 326 | Protein_67 | hypothetical protein | - |
| MKZ44_RS27835 (MKZ44_27830) | 62600..62848 | - | 249 | WP_004152675 | hypothetical protein | - |
| MKZ44_RS27840 (MKZ44_27835) | 62826..63080 | - | 255 | WP_004152674 | conjugal transfer protein TrbE | - |
| MKZ44_RS29195 | 63112..65063 | - | 1952 | Protein_70 | type-F conjugative transfer system mating-pair stabilization protein TraN | - |
| MKZ44_RS27860 (MKZ44_27855) | 65122..65760 | - | 639 | WP_004152672 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| MKZ44_RS27865 (MKZ44_27860) | 65773..66761 | - | 989 | Protein_72 | conjugal transfer pilus assembly protein TraU | - |
| MKZ44_RS27870 (MKZ44_27865) | 66758..67146 | - | 389 | Protein_73 | hypothetical protein | - |
| MKZ44_RS27875 (MKZ44_27870) | 67188..67813 | - | 626 | Protein_74 | type-F conjugative transfer system protein TraW | - |
| MKZ44_RS27880 (MKZ44_27875) | 67813..68202 | - | 390 | WP_004152506 | type-F conjugative transfer system protein TrbI | - |
| MKZ44_RS27885 (MKZ44_27880) | 68202..70840 | - | 2639 | Protein_76 | type IV secretion system protein TraC | - |
| MKZ44_RS27890 (MKZ44_27885) | 70912..71310 | - | 399 | WP_011977783 | hypothetical protein | - |
| MKZ44_RS27895 (MKZ44_27890) | 71318..71560 | - | 243 | WP_004158946 | hypothetical protein | - |
| MKZ44_RS27900 (MKZ44_27895) | 71747..72150 | - | 404 | Protein_79 | hypothetical protein | - |
| MKZ44_RS27905 (MKZ44_27900) | 72195..72526 | - | 332 | Protein_80 | hypothetical protein | - |
| MKZ44_RS27910 (MKZ44_27905) | 72527..72745 | - | 219 | WP_004152501 | hypothetical protein | - |
| MKZ44_RS27915 (MKZ44_27910) | 72851..73261 | - | 411 | WP_004152499 | hypothetical protein | - |
| MKZ44_RS27920 (MKZ44_27915) | 73393..73977 | - | 585 | WP_004161368 | type IV conjugative transfer system lipoprotein TraV | traV |
| MKZ44_RS27925 (MKZ44_27920) | 74092..75514 | - | 1423 | Protein_84 | F-type conjugal transfer pilus assembly protein TraB | - |
| MKZ44_RS27930 (MKZ44_27925) | 75514..76259 | - | 746 | Protein_85 | type-F conjugative transfer system secretin TraK | - |
| MKZ44_RS27935 (MKZ44_27930) | 76245..76805 | - | 561 | Protein_86 | type IV conjugative transfer system protein TraE | - |
| MKZ44_RS27940 (MKZ44_27935) | 76825..77130 | - | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| MKZ44_RS27945 (MKZ44_27940) | 77144..77510 | - | 367 | Protein_88 | type IV conjugative transfer system pilin TraA | - |
| MKZ44_RS27950 (MKZ44_27945) | 77564..77950 | - | 387 | WP_004152495 | TraY domain-containing protein | - |
| MKZ44_RS27955 (MKZ44_27950) | 78029..78715 | - | 687 | WP_004152494 | transcriptional regulator TraJ family protein | - |
| MKZ44_RS27960 (MKZ44_27955) | 78889..79287 | - | 399 | WP_004152493 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| MKZ44_RS27965 (MKZ44_27960) | 79709..80194 | + | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| MKZ44_RS27970 (MKZ44_27965) | 80227..80556 | - | 330 | WP_011977736 | DUF5983 family protein | - |
| MKZ44_RS27975 (MKZ44_27970) | 80589..81408 | - | 820 | Protein_94 | DUF932 domain-containing protein | - |
| MKZ44_RS27980 (MKZ44_27975) | 82228..83061 | - | 834 | WP_004152751 | N-6 DNA methylase | - |
| MKZ44_RS27985 (MKZ44_27980) | 83112..83258 | - | 147 | WP_004152750 | hypothetical protein | - |
| MKZ44_RS27990 (MKZ44_27985) | 83353..83700 | - | 348 | WP_004152749 | hypothetical protein | - |
| MKZ44_RS27995 (MKZ44_27990) | 83757..84110 | - | 354 | WP_004152748 | hypothetical protein | - |
| MKZ44_RS28000 (MKZ44_27995) | 84737..85093 | - | 357 | WP_240729871 | hypothetical protein | - |
Host bacterium
| ID | 6034 | GenBank | NZ_CP092755 |
| Plasmid name | bat17|unnamed2 | Incompatibility group | IncFII |
| Plasmid size | 118840 bp | Coordinate of oriT [Strand] | 79587..79636 [+] |
| Host baterium | Klebsiella pneumoniae strain bat17 |
Cargo genes
| Drug resistance gene | blaTEM-1A, blaOXA-9, blaKPC-3 |
| Virulence gene | - |
| Metal resistance gene | merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |