Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105572
Name   oriT_STLEFF_28|unnamed6 in_silico
Organism   Klebsiella quasipneumoniae strain STLEFF_28
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP058865 (1189..1248 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_STLEFF_28|unnamed6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6010 GenBank   NZ_CP058865
Plasmid name   STLEFF_28|unnamed6 Incompatibility group   -
Plasmid size   2148 bp Coordinate of oriT [Strand]   1189..1248 [-]
Host baterium   Klebsiella quasipneumoniae strain STLEFF_28

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -