Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105566
Name   oriT_NAS_AN_285|unnamed in_silico
Organism   Staphylococcus aureus strain NAS_AN_285
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP062440 (2726..2914 [+], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      149..156, 161..168  (CTATCATT..AATGATAG)
 133..138, 142..147  (TCTGGC..GCCAGA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_NAS_AN_285|unnamed
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAATAAGACAAACGCAATATATTGTGTCACAAAAATAAGACAGTACAGCTTTGTATGATATCACTTTAAAATACCTTAAAACCCCTGGAATTTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   6004 GenBank   NZ_CP062440
Plasmid name   NAS_AN_285|unnamed Incompatibility group   -
Plasmid size   3126 bp Coordinate of oriT [Strand]   2726..2914 [+]
Host baterium   Staphylococcus aureus strain NAS_AN_285

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -