Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105551 |
| Name | oriT_pSNE1-2012K-0938 |
| Organism | Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP025247 (1464..1520 [+], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pSNE1-2012K-0938
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5989 | GenBank | NZ_CP025247 |
| Plasmid name | pSNE1-2012K-0938 | Incompatibility group | Col440I |
| Plasmid size | 2579 bp | Coordinate of oriT [Strand] | 1464..1520 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |