Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 105510
• Name: oriT_pHKU2
• Organism: Superficieibacter sp. HKU1
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP119756 (1044..1103 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pHKU2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 5948
• GenBank: NZ_CP119756
• Plasmid name: pHKU2
• Incompatibility group: ColRNAI
• Plasmid size: 2175 bp
• Coordinate of oriT [Strand]: 1044..1103 [+]
• Host baterium: Superficieibacter sp. HKU1

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -