Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105501 |
| Name | oriT_pKAM644_12 |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM644 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP026419 (910..965 [-], 56 nt) |
| oriT length | 56 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 56 nt
>oriT_pKAM644_12
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACTCCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACTCCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5939 | GenBank | NZ_AP026419 |
| Plasmid name | pKAM644_12 | Incompatibility group | - |
| Plasmid size | 1597 bp | Coordinate of oriT [Strand] | 910..965 [-] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM644 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |