Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105500 |
Name | oriT_pKAM644_11 |
Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM644 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_AP026418 (1525..1709 [-], 185 nt) |
oriT length | 185 nt |
IRs (inverted repeats) | 105..110, 115..120 (ACCCCC..GGGGGT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 185 nt
>oriT_pKAM644_11
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTATGGGTAAAGCGAAGCGAACCCGTAAAACTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTTGAGCGACAGCGAAAAAATAGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTATGGGTAAAGCGAAGCGAACCCGTAAAACTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTTGAGCGACAGCGAAAAAATAGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 5938 | GenBank | NZ_AP026418 |
Plasmid name | pKAM644_11 | Incompatibility group | Col |
Plasmid size | 2322 bp | Coordinate of oriT [Strand] | 1525..1709 [-] |
Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM644 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |