Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105499 |
| Name | oriT_pKAM644_8  |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM644 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP026415 (1856..1906 [+], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_pKAM644_8
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5937 | GenBank | NZ_AP026415 |
| Plasmid name | pKAM644_8 | Incompatibility group | Col440I |
| Plasmid size | 4730 bp | Coordinate of oriT [Strand] | 1856..1906 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM644 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |