Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105494 |
| Name | oriT_pKAM622_10  |
| Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM622 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AP026402 (816..871 [+], 56 nt) |
| oriT length | 56 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 56 nt
>oriT_pKAM622_10
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACTCCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACTCCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5932 | GenBank | NZ_AP026402 |
| Plasmid name | pKAM622_10 | Incompatibility group | - |
| Plasmid size | 1581 bp | Coordinate of oriT [Strand] | 816..871 [+] |
| Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM622 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |