Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105493
Name   oriT_pKAM622_9 in_silico
Organism   Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM622
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AP026401 (1998..2182 [+], 185 nt)
oriT length   185 nt
IRs (inverted repeats)      105..110, 115..120  (ACCCCC..GGGGGT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 185 nt

>oriT_pKAM622_9
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTATGGGTAAAGCGAAGCGAACCCGTAAAACTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTTGAGCGACAGCGAAAAAATAGAACATAAGGGGGGAGGGTTTGGGTTTTACGG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5931 GenBank   NZ_AP026401
Plasmid name   pKAM622_9 Incompatibility group   Col
Plasmid size   2290 bp Coordinate of oriT [Strand]   1998..2182 [+]
Host baterium   Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM622

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -