Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105493 |
Name | oriT_pKAM622_9 |
Organism | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM622 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_AP026401 (1998..2182 [+], 185 nt) |
oriT length | 185 nt |
IRs (inverted repeats) | 105..110, 115..120 (ACCCCC..GGGGGT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 185 nt
>oriT_pKAM622_9
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTATGGGTAAAGCGAAGCGAACCCGTAAAACTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTTGAGCGACAGCGAAAAAATAGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTATGGGTAAAGCGAAGCGAACCCGTAAAACTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTTGAGCGACAGCGAAAAAATAGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 5931 | GenBank | NZ_AP026401 |
Plasmid name | pKAM622_9 | Incompatibility group | Col |
Plasmid size | 2290 bp | Coordinate of oriT [Strand] | 1998..2182 [+] |
Host baterium | Klebsiella quasipneumoniae subsp. quasipneumoniae strain KAM622 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |