Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105446 |
| Name | oriT_pK186_KPC  |
| Organism | Klebsiella pneumoniae strain K186 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP076521 (15268..15365 [-], 98 nt) |
| oriT length | 98 nt |
| IRs (inverted repeats) | 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
| Location of nic site | 59..60 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 98 nt
>oriT_pK186_KPC
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5884 | GenBank | NZ_CP076521 |
| Plasmid name | pK186_KPC | Incompatibility group | IncN |
| Plasmid size | 26021 bp | Coordinate of oriT [Strand] | 15268..15365 [-] |
| Host baterium | Klebsiella pneumoniae strain K186 |
Cargo genes
| Drug resistance gene | blaKPC-2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |