Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105434
Name   oriT_CriePir26|unnamed4 in_silico
Organism   Klebsiella pneumoniae strain CriePir26
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP062990 (5472..5632 [-], 161 nt)
oriT length   161 nt
IRs (inverted repeats)      40..45, 49..54  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 161 nt

>oriT_CriePir26|unnamed4
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5872 GenBank   NZ_CP062990
Plasmid name   CriePir26|unnamed4 Incompatibility group   IncQ1
Plasmid size   8350 bp Coordinate of oriT [Strand]   5472..5632 [-]
Host baterium   Klebsiella pneumoniae strain CriePir26

Cargo genes


Drug resistance gene   aph(3')-VIa
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -