Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105399
Name   oriT_p28296-2 in_silico
Organism   Salmonella enterica subsp. enterica serovar Choleraesuis strain CVM 28296
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP051365 (554..713 [+], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_p28296-2
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5837 GenBank   NZ_CP051365
Plasmid name   p28296-2 Incompatibility group   IncQ1
Plasmid size   8688 bp Coordinate of oriT [Strand]   554..713 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Choleraesuis strain CVM 28296

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -