Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105398
Name   oriT_p30168-2 in_silico
Organism   Salmonella enterica subsp. enterica serovar Schwarzengrund strain CVM 30168
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP051352 (8584..8743 [-], 160 nt)
oriT length   160 nt
IRs (inverted repeats)      39..44, 48..53  (CCCTAC..GTAGGG)
 6..12, 16..22  (GTTTCTC..GAGAAAC)
Location of nic site      33..34
Conserved sequence flanking the
  nic site  
 
 GTGCGCCCTC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 160 nt

>oriT_p30168-2
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5836 GenBank   NZ_CP051352
Plasmid name   p30168-2 Incompatibility group   IncQ1
Plasmid size   9569 bp Coordinate of oriT [Strand]   8584..8743 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Schwarzengrund strain CVM 30168

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -