Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105396
Name   oriT_p28321a-5 in_silico
Organism   Salmonella enterica subsp. enterica serovar Typhimurium strain CVM 28321-a
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP054466 (1..251 [-], 251 nt)
oriT length   251 nt
IRs (inverted repeats)      184..189, 197..202  (ATAAAA..TTTTAT)
 130..138, 148..156  (GCGGTGTTG..CAACACCGC)
 31..37, 42..48  (GCAAAAA..TTTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 251 nt

>oriT_p28321a-5
GTTCTCATGCCTGAAATGCCCACACCCCACGCAAAAACAATTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGACAAATTAGTTCTTCTTGCTCTCTTTGTGATATTTAAAAAAGCGGTGTCGGCGCGGTGTTGTAGCTGCGCCAACACCGCTTTTTAGGGGTGGTACTGACTATTTTCATAAAAAACATCATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTTACAGGACGCCCC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5834 GenBank   NZ_CP054466
Plasmid name   p28321a-5 Incompatibility group   ColRNAI
Plasmid size   3188 bp Coordinate of oriT [Strand]   1..251 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Typhimurium strain CVM 28321-a

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -