Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105367
Name   oriT_p5512.56-4 in_silico
Organism   Klebsiella grimontii strain 5512.56
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP067388 (2880..2939 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p5512.56-4
GGGTTTCGGGGCGCAACCCTGAACCAGTCACGTAGCGCTAGCAGAGTGTATAATGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5805 GenBank   NZ_CP067388
Plasmid name   p5512.56-4 Incompatibility group   Col440I
Plasmid size   9581 bp Coordinate of oriT [Strand]   2880..2939 [-]
Host baterium   Klebsiella grimontii strain 5512.56

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -