Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105360 |
| Name | oriT_PR05720-3|unnamed_2  |
| Organism | Enterococcus faecium strain PR05720-3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP064408 (12478..12615 [+], 138 nt) |
| oriT length | 138 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 138 nt
>oriT_PR05720-3|unnamed_2
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCTTTTTCAAGCCACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCCAGTATTTATGGTTTTATATTTGCTATTTTGTT
CGACACAATCCAAAGGGGATAAAAGGGGAAAGTGAAACTTCCCCTTTTTCAAGCCACATTGTAATACAAGAACGAAGTGATTTGTATTACAATGTGATAGCTTGCCAGTATTTATGGTTTTATATTTGCTATTTTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5798 | GenBank | NZ_CP064408 |
| Plasmid name | PR05720-3|unnamed_2 | Incompatibility group | - |
| Plasmid size | 62662 bp | Coordinate of oriT [Strand] | 12478..12615 [+] |
| Host baterium | Enterococcus faecium strain PR05720-3 |
Cargo genes
| Drug resistance gene | ClpL |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |