Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105351 |
| Name | oriT_pEH_316-6  |
| Organism | Enterobacter hormaechei strain EH_316 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP078061 (1419..1478 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pEH_316-6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5789 | GenBank | NZ_CP078061 |
| Plasmid name | pEH_316-6 | Incompatibility group | Col440II |
| Plasmid size | 4783 bp | Coordinate of oriT [Strand] | 1419..1478 [+] |
| Host baterium | Enterobacter hormaechei strain EH_316 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |