Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105340 |
| Name | oriT_pBs162S2b  |
| Organism | Bradyrhizobium septentrionale strain 162S2 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP088290 (9113..9168 [-], 56 nt) |
| oriT length | 56 nt |
| IRs (inverted repeats) | 23..29, 34..40 (ACGTCGC..GCGACGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 56 nt
>oriT_pBs162S2b
CCCCGGCAGGCGGGAAAACAGGACGTCGCGGATGCGACGTATTACTGCGCCCTTGG
CCCCGGCAGGCGGGAAAACAGGACGTCGCGGATGCGACGTATTACTGCGCCCTTGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5778 | GenBank | NZ_CP088290 |
| Plasmid name | pBs162S2b | Incompatibility group | - |
| Plasmid size | 200222 bp | Coordinate of oriT [Strand] | 9113..9168 [-] |
| Host baterium | Bradyrhizobium septentrionale strain 162S2 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |