Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105327 |
| Name | oriT_pMAR14456-IncHI1B  |
| Organism | Klebsiella pneumoniae strain MAR14-456 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP063278 (171914..171941 [+], 28 nt) |
| oriT length | 28 nt |
| IRs (inverted repeats) | 16..21, 23..28 (ATCAGA..TCTGAT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 28 nt
>oriT_pMAR14456-IncHI1B
AGTTTGGTGCTTATGATCAGAATCTGAT
AGTTTGGTGCTTATGATCAGAATCTGAT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5765 | GenBank | NZ_CP063278 |
| Plasmid name | pMAR14456-IncHI1B | Incompatibility group | IncFIB |
| Plasmid size | 232362 bp | Coordinate of oriT [Strand] | 171914..171941 [+] |
| Host baterium | Klebsiella pneumoniae strain MAR14-456 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | iroB, iroC, iroD, iroN, rmpA, iucA, iucB, iucC, iutA |
| Metal resistance gene | silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pbrA, terE, terD, terC, terB, terA, terZ, terW |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |