Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105323
Name   oriT_RHBSTW-00268|unnamed in_silico
Organism   Klebsiella quasipneumoniae strain RHBSTW-00268
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055341 (12..70 [+], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_RHBSTW-00268|unnamed
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5761 GenBank   NZ_CP055341
Plasmid name   RHBSTW-00268|unnamed Incompatibility group   ColRNAI
Plasmid size   3156 bp Coordinate of oriT [Strand]   12..70 [+]
Host baterium   Klebsiella quasipneumoniae strain RHBSTW-00268

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -