Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105310
Name   oriT_pRHBSTW-00444_2 in_silico
Organism   Citrobacter freundii strain RHBSTW-00444
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP056516 (83956..84240 [+], 285 nt)
oriT length   285 nt
IRs (inverted repeats)      184..189, 191..196  (AAAAGT..ACTTTT)
Location of nic site      109..110
Conserved sequence flanking the
  nic site  
 
 TTTGGTTAAA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 285 nt

>oriT_pRHBSTW-00444_2
GGTTATTGCTACTTAATGCCGATAACGACTCAGGCTTTGAGGTTTTTTTATACGGTTCACATTTCGTTAGCAAGGTCAGGGTTTTTTGATAAAATTCTGGTTAGTTTGGTTAAAAAGTGTTACAAGTATGGGTAATGGCTGAAAGGTTAGTTTTAAGGTTCAAAGCGGCAGTATTAAAATTCCAAAAGTTACTTTTCATCCTTCAGAATCCAGACCTTAATTTCATGTAGAAGATTCGTACAATTGTATTGGCGCAAGGACAATCCGCACATGTCAGAATCAGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5748 GenBank   NZ_CP056516
Plasmid name   pRHBSTW-00444_2 Incompatibility group   IncFIB
Plasmid size   216816 bp Coordinate of oriT [Strand]   83956..84240 [+]
Host baterium   Citrobacter freundii strain RHBSTW-00444

Cargo genes


Drug resistance gene   aph(3'')-Ib, aph(6)-Id
Virulence gene   -
Metal resistance gene   arsC, arsB, arsA, arsD, arsR, merE, merD, merA, merC, merP, merT, merR
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -