Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105298
Name   oriT_RHB18-C03|unnamed in_silico
Organism   Escherichia fergusonii strain RHB18-C03
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055701 (80..139 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_RHB18-C03|unnamed
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5736 GenBank   NZ_CP055701
Plasmid name   RHB18-C03|unnamed Incompatibility group   -
Plasmid size   215 bp Coordinate of oriT [Strand]   80..139 [+]
Host baterium   Escherichia fergusonii strain RHB18-C03

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -