Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105295
Name   oriT_pRHB28-C21_7 in_silico
Organism   Escherichia fergusonii strain RHB28-C21
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP057363 (1374..1433 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHB28-C21_7
GGGTGTCGGGGCGAAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5733 GenBank   NZ_CP057363
Plasmid name   pRHB28-C21_7 Incompatibility group   Col
Plasmid size   1552 bp Coordinate of oriT [Strand]   1374..1433 [+]
Host baterium   Escherichia fergusonii strain RHB28-C21

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -