Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105293 |
Name | oriT_pRHB28-C21_5 |
Organism | Escherichia fergusonii strain RHB28-C21 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP057361 (1081..1140 [-], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pRHB28-C21_5
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 5731 | GenBank | NZ_CP057361 |
Plasmid name | pRHB28-C21_5 | Incompatibility group | ColRNAI |
Plasmid size | 5055 bp | Coordinate of oriT [Strand] | 1081..1140 [-] |
Host baterium | Escherichia fergusonii strain RHB28-C21 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |