Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105290 |
| Name | oriT_pRHB30-C02_3  |
| Organism | Klebsiella oxytoca strain RHB30-C02 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP057332 (4842..4901 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pRHB30-C02_3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5728 | GenBank | NZ_CP057332 |
| Plasmid name | pRHB30-C02_3 | Incompatibility group | ColRNAI |
| Plasmid size | 6790 bp | Coordinate of oriT [Strand] | 4842..4901 [+] |
| Host baterium | Klebsiella oxytoca strain RHB30-C02 |
Cargo genes
| Drug resistance gene | dfrA14, aph(6)-Id, sul2 |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |