Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105271
Name   oriT_pRHBSTW-00229_2 in_silico
Organism   Citrobacter sp. RHBSTW-00229
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP056648 (14634..14918 [-], 285 nt)
oriT length   285 nt
IRs (inverted repeats)      184..189, 191..196  (AAAAGT..ACTTTT)
Location of nic site      109..110
Conserved sequence flanking the
  nic site  
 
 TTTGGTTAAA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 285 nt

>oriT_pRHBSTW-00229_2
GGTTATTGCTACTTAATGCCGATAACGACTCAGGCTTTGAGGTTTTTTTATACGGTTCACATTTCGTTAGCAAGGTCAGGGTTTTTTGATAAAATTCTGGTTAGTTTGGTTAAAAAGTGTTACAAGTATGGGTAATGGCTGAAAGGTTAGTTTTAAGGTTCAAAGCGGCAGTATTAAAATTCCAAAAGTTACTTTTCATCCTTCAGAATCCAGACCTTAATTTCATGTAGAAGATTCGTACAATTGTATTGGCGCAAGGACAATCCGCACATGTCAGAATCAGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5709 GenBank   NZ_CP056648
Plasmid name   pRHBSTW-00229_2 Incompatibility group   IncFIB
Plasmid size   78367 bp Coordinate of oriT [Strand]   14634..14918 [-]
Host baterium   Citrobacter sp. RHBSTW-00229

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsC, arsB, arsA, arsD, arsR
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -