Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105270
Name   oriT_pRHBSTW-00181_6 in_silico
Organism   Klebsiella grimontii strain RHBSTW-00181
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP058117 (274..373 [+], 100 nt)
oriT length   100 nt
IRs (inverted repeats)      80..85, 90..95  (AAAAAT..ATTTTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 100 nt

>oriT_pRHBSTW-00181_6
TATTCCTTTTTTTTCTTTTAATTCATGTAGTTGCGATGAAAATCGCGGCTGCGTTAGGTGTATGACCATTTAAGGGTTAAAAAATCATCATTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5708 GenBank   NZ_CP058117
Plasmid name   pRHBSTW-00181_6 Incompatibility group   -
Plasmid size   1697 bp Coordinate of oriT [Strand]   274..373 [+]
Host baterium   Klebsiella grimontii strain RHBSTW-00181

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -