Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105268 |
| Name | oriT_pRHBSTW-00181_3  |
| Organism | Klebsiella grimontii strain RHBSTW-00181 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058114 (74143..74192 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pRHBSTW-00181_3
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 73590..87528
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HV112_RS28950 (HV112_28955) | 68692..69420 | + | 729 | WP_004118966 | plasmid SOS inhibition protein A | - |
| HV112_RS29470 | 69417..69504 | + | 88 | Protein_82 | theronine dehydrogenase | - |
| HV112_RS28955 (HV112_28960) | 69824..70153 | + | 330 | WP_004118963 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| HV112_RS28960 (HV112_28965) | 70134..70415 | + | 282 | WP_004118961 | helix-turn-helix transcriptional regulator | - |
| HV112_RS28965 (HV112_28970) | 71234..71509 | + | 276 | WP_032700867 | hypothetical protein | - |
| HV112_RS28970 (HV112_28975) | 71566..71724 | + | 159 | WP_162180130 | hypothetical protein | - |
| HV112_RS28975 (HV112_28980) | 71750..72097 | + | 348 | WP_032700835 | hypothetical protein | - |
| HV112_RS28980 (HV112_28985) | 72191..72337 | + | 147 | WP_032700834 | hypothetical protein | - |
| HV112_RS28985 (HV112_28990) | 73022..73552 | + | 531 | WP_032716647 | antirestriction protein | - |
| HV112_RS28990 (HV112_28995) | 73590..74069 | - | 480 | WP_032716648 | transglycosylase SLT domain-containing protein | virB1 |
| HV112_RS28995 (HV112_29000) | 74494..74883 | + | 390 | WP_032700831 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| HV112_RS29000 (HV112_29005) | 75294..75773 | + | 480 | WP_227502493 | hypothetical protein | - |
| HV112_RS29005 (HV112_29010) | 75952..76107 | + | 156 | WP_227538793 | TraY domain-containing protein | - |
| HV112_RS29010 (HV112_29015) | 76180..76548 | + | 369 | WP_032700830 | type IV conjugative transfer system pilin TraA | - |
| HV112_RS29015 (HV112_29020) | 76562..76867 | + | 306 | WP_020323523 | type IV conjugative transfer system protein TraL | traL |
| HV112_RS29020 (HV112_29025) | 76887..77453 | + | 567 | WP_032700829 | type IV conjugative transfer system protein TraE | traE |
| HV112_RS29025 (HV112_29030) | 77440..78174 | + | 735 | WP_032700828 | type-F conjugative transfer system secretin TraK | traK |
| HV112_RS29030 (HV112_29035) | 78174..79592 | + | 1419 | WP_032700827 | F-type conjugal transfer pilus assembly protein TraB | traB |
| HV112_RS29035 (HV112_29040) | 79585..80181 | + | 597 | WP_110214260 | conjugal transfer protein TraP | - |
| HV112_RS29040 (HV112_29045) | 80162..80368 | + | 207 | WP_032700826 | hypothetical protein | - |
| HV112_RS29045 (HV112_29050) | 80387..80956 | + | 570 | WP_071887221 | type IV conjugative transfer system lipoprotein TraV | traV |
| HV112_RS29475 | 81063..81542 | + | 480 | WP_227538792 | hypothetical protein | - |
| HV112_RS29055 (HV112_29060) | 82024..82245 | + | 222 | WP_032732073 | hypothetical protein | - |
| HV112_RS29060 (HV112_29065) | 82242..82646 | + | 405 | WP_032732076 | hypothetical protein | - |
| HV112_RS29065 (HV112_29070) | 82643..82996 | + | 354 | WP_032732078 | hypothetical protein | - |
| HV112_RS29070 (HV112_29075) | 82999..83388 | + | 390 | WP_032732080 | hypothetical protein | - |
| HV112_RS29075 (HV112_29080) | 83402..83791 | + | 390 | WP_032732086 | hypothetical protein | - |
| HV112_RS29080 (HV112_29085) | 83871..86510 | + | 2640 | WP_032700820 | type IV secretion system protein TraC | virb4 |
| HV112_RS29085 (HV112_29090) | 86510..86902 | + | 393 | WP_032700819 | type-F conjugative transfer system protein TrbI | - |
| HV112_RS29090 (HV112_29095) | 86899..87528 | + | 630 | WP_032732087 | type-F conjugative transfer system protein TraW | traW |
| HV112_RS29095 (HV112_29100) | 87569..88354 | + | 786 | Protein_111 | conjugal transfer pilus assembly protein TraU | - |
| HV112_RS29100 (HV112_29105) | 88342..92256 | + | 3915 | Protein_112 | conjugative transfer relaxase/helicase TraI domain-containing protein | - |
Host bacterium
| ID | 5706 | GenBank | NZ_CP058114 |
| Plasmid name | pRHBSTW-00181_3 | Incompatibility group | IncFIA |
| Plasmid size | 98663 bp | Coordinate of oriT [Strand] | 74143..74192 [-] |
| Host baterium | Klebsiella grimontii strain RHBSTW-00181 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsH, arsC, arsB |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |