Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 105265
• Name: oriT_pRHBSTW-00153_10
• Organism: Citrobacter freundii strain RHBSTW-00153
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_CP055573 (347..406 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: 48..49
• Conserved sequence flanking the nic site: GTGTGTATAC
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_pRHBSTW-00153_10
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGACGCGCTAGCGGTGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 5703
• GenBank: NZ_CP055573
• Plasmid name: pRHBSTW-00153_10
• Incompatibility group: -
• Plasmid size: 1488 bp
• Coordinate of oriT [Strand]: 347..406 [+]
• Host baterium: Citrobacter freundii strain RHBSTW-00153

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -