Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105261
Name   oriT_RHBSTW-00488|unnamed in_silico
Organism   Citrobacter freundii strain RHBSTW-00488
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP055469 (39046..39330 [-], 285 nt)
oriT length   285 nt
IRs (inverted repeats)      184..189, 191..196  (AAAAGT..ACTTTT)
Location of nic site      109..110
Conserved sequence flanking the
  nic site  
 
 TTTGGTTAAA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 285 nt

>oriT_RHBSTW-00488|unnamed
GGTTATTGCTACTTAATGCCGATAACGACTCAGGCTTTGAGGTTTTTTTATACGGTTCACATTTCGTTAGCAAGGTCAGGGTTTTTTGATAAAATTCTGGTTAGTTTGGTTAAAAAGTGTTACAAGTATGGGTAATGGCTGAAAGGTTAGTTTTAAGGTTCAAAGCGGCAGTATTAAAATTCCAAAAGTTACTTTTCATCCTTCAGAATCCAGACCTTAATTTCATGTAGAAGATTCGTACAATTGTATTGGCGCAAGGACAATCCGCACATGTCAGAATCAGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5699 GenBank   NZ_CP055469
Plasmid name   RHBSTW-00488|unnamed Incompatibility group   IncFIB
Plasmid size   78741 bp Coordinate of oriT [Strand]   39046..39330 [-]
Host baterium   Citrobacter freundii strain RHBSTW-00488

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsR, arsD, arsA, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -