Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105260 |
| Name | oriT_pRHBSTW-00167_9  |
| Organism | Klebsiella michiganensis strain RHBSTW-00167 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058126 (2725..2776 [-], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_pRHBSTW-00167_9
AAATCTGCAAAATTAAAATTTTGCGTGGGGTGTGGGTATTTTTCGTGGTGAG
AAATCTGCAAAATTAAAATTTTGCGTGGGGTGTGGGTATTTTTCGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5698 | GenBank | NZ_CP058126 |
| Plasmid name | pRHBSTW-00167_9 | Incompatibility group | - |
| Plasmid size | 5010 bp | Coordinate of oriT [Strand] | 2725..2776 [-] |
| Host baterium | Klebsiella michiganensis strain RHBSTW-00167 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |