Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105258 |
| Name | oriT_pRHBSTW-00167_7  |
| Organism | Klebsiella michiganensis strain RHBSTW-00167 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058124 (1627..1678 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_pRHBSTW-00167_7
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGTGGGTATTTTTCGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGTGGGTATTTTTCGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5696 | GenBank | NZ_CP058124 |
| Plasmid name | pRHBSTW-00167_7 | Incompatibility group | ColRNAI |
| Plasmid size | 5499 bp | Coordinate of oriT [Strand] | 1627..1678 [+] |
| Host baterium | Klebsiella michiganensis strain RHBSTW-00167 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |