Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 105253 |
Name | oriT_pRHBSTW-00658_3 |
Organism | Citrobacter freundii strain RHBSTW-00658 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_CP056367 (2163..2222 [-], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pRHBSTW-00658_3
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 5691 | GenBank | NZ_CP056367 |
Plasmid name | pRHBSTW-00658_3 | Incompatibility group | Col440II |
Plasmid size | 7720 bp | Coordinate of oriT [Strand] | 2163..2222 [-] |
Host baterium | Citrobacter freundii strain RHBSTW-00658 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |