Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105251 |
| Name | oriT_pRHBSTW-00472_8  |
| Organism | Klebsiella pneumoniae strain RHBSTW-00472 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055516 (1618..1677 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pRHBSTW-00472_8
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGCAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5689 | GenBank | NZ_CP055516 |
| Plasmid name | pRHBSTW-00472_8 | Incompatibility group | Col440I |
| Plasmid size | 1919 bp | Coordinate of oriT [Strand] | 1618..1677 [+] |
| Host baterium | Klebsiella pneumoniae strain RHBSTW-00472 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |