Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105249 |
| Name | oriT_pRHBSTW-00472_6  |
| Organism | Klebsiella pneumoniae strain RHBSTW-00472 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055514 (3957..4006 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pRHBSTW-00472_6
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTGGTGTGTGGGTATTTTTCGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5687 | GenBank | NZ_CP055514 |
| Plasmid name | pRHBSTW-00472_6 | Incompatibility group | ColRNAI |
| Plasmid size | 4184 bp | Coordinate of oriT [Strand] | 3957..4006 [-] |
| Host baterium | Klebsiella pneumoniae strain RHBSTW-00472 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |