Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105236 |
| Name | oriT_pRHBSTW-00634_8  |
| Organism | Klebsiella grimontii strain RHBSTW-00634 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP056689 (2523..2579 [-], 57 nt) |
| oriT length | 57 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 57 nt
>oriT_pRHBSTW-00634_8
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTAGCT
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTAGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5674 | GenBank | NZ_CP056689 |
| Plasmid name | pRHBSTW-00634_8 | Incompatibility group | Col440I |
| Plasmid size | 5754 bp | Coordinate of oriT [Strand] | 2523..2579 [-] |
| Host baterium | Klebsiella grimontii strain RHBSTW-00634 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |