Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105226
Name   oriT_pRHBSTW-01009_3 in_silico
Organism   Enterobacter asburiae strain RHBSTW-01009
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP056128 (1050..1106 [+], 57 nt)
oriT length   57 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 57 nt

>oriT_pRHBSTW-01009_3
GGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5664 GenBank   NZ_CP056128
Plasmid name   pRHBSTW-01009_3 Incompatibility group   ColRNAI
Plasmid size   2722 bp Coordinate of oriT [Strand]   1050..1106 [+]
Host baterium   Enterobacter asburiae strain RHBSTW-01009

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -