Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105225 |
| Name | oriT_pRHBSTW-00165_12  |
| Organism | Klebsiella grimontii strain RHBSTW-00165 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP055375 (1463..1512 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 5..12, 15..22 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pRHBSTW-00165_12
ATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
ATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5663 | GenBank | NZ_CP055375 |
| Plasmid name | pRHBSTW-00165_12 | Incompatibility group | Col440I |
| Plasmid size | 3271 bp | Coordinate of oriT [Strand] | 1463..1512 [+] |
| Host baterium | Klebsiella grimontii strain RHBSTW-00165 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |