Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105224 |
| Name | oriT_pRHBSTW-01009_2  |
| Organism | Enterobacter asburiae strain RHBSTW-01009 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP056127 (62665..62759 [-], 95 nt) |
| oriT length | 95 nt |
| IRs (inverted repeats) | 73..78, 85..90 (AAAAAA..TTTTTT) 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
| Location of nic site | 55..56 |
| Conserved sequence flanking the nic site |
GGTGTATAGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 95 nt
>oriT_pRHBSTW-01009_2
TTTTTTTTCTTTTAAATCAGTTAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTTAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5662 | GenBank | NZ_CP056127 |
| Plasmid name | pRHBSTW-01009_2 | Incompatibility group | IncFIB |
| Plasmid size | 70650 bp | Coordinate of oriT [Strand] | 62665..62759 [-] |
| Host baterium | Enterobacter asburiae strain RHBSTW-01009 |
Cargo genes
| Drug resistance gene | mcr-10 |
| Virulence gene | mrkA, mrkB, mrkC, mrkD, mrkF |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |