Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   105204
Name   oriT1_pRHB10-C23_3 in_silico
Organism   Escherichia fergusonii strain RHB10-C23
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_CP057898 (1096..1183 [-], 88 nt)
oriT length   88 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 88 nt

>oriT1_pRHB10-C23_3
GGGTGTCGGGGCGCAGCCCTGACCAGGTGGTAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTACACATCCTGTCCCGATTTTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   5642 GenBank   NZ_CP057898
Plasmid name   pRHB10-C23_3 Incompatibility group   ColpVC
Plasmid size   2064 bp Coordinate of oriT [Strand]   1096..1183 [-]; 683..765 [+]
Host baterium   Escherichia fergusonii strain RHB10-C23

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -