Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 105190 |
| Name | oriT_pRHBSTW-00039_7  |
| Organism | Klebsiella grimontii strain RHBSTW-00039 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_CP058186 (1005..1056 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 7..12, 19..24 (GCAAAA..TTTTGC) 10..15, 17..22 (AAAATT..AATTTT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_pRHBSTW-00039_7
AAATCTGCAAAAATTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AAATCTGCAAAAATTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 5628 | GenBank | NZ_CP058186 |
| Plasmid name | pRHBSTW-00039_7 | Incompatibility group | Col440I |
| Plasmid size | 3294 bp | Coordinate of oriT [Strand] | 1005..1056 [+] |
| Host baterium | Klebsiella grimontii strain RHBSTW-00039 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |